Cell isolation and culture
Human umbilical cord tissues were obtained from healthy donors after delivery and handled within 1 h. Dulbecco's Phosphate Buffered Saline (DPBS, Gibco, A12858-01, NY, USA) containing 1% Penicillin–Streptomycin (PS, Gibco, 15140122, NY, USA) was used to wash tissues three times and umbilical cord was cut into fragments with sterile surgical instruments. A total of 10 ml type I collagenase (Gibco, 17100017, NY, USA) including 2.5 U/mL Dispase II (SIGMA, D4693, NY, USA) was used to digest tissues in shaking bed (37 °C, 220 r/min). The digestion process lasted for 2 h and was terminated by adding complete medium (DMEM, Gibco, 10567014, NY, USA) containing 10% fetal bovine serum (FBS, Gibco, 12664025, NY, USA). Cell pellets were inoculated in culture flask with complete medium and cultured in a cell incubator (37 °C, 5% CO2) after centrifugation at 300 g for 15 min. The nonadherent cells were discarded by changing complete medium after 48 h. MSCs growing up to 80–90% confluence were defined as the primary passage (P0).
Foreskin tissues were obtained from the departments of andrology, Nanjing Drum Tower Hospital. Foreskin from a healthy male after circumcision was taken to the laboratory with 0.9% normal saline and was rinsed 3 times in PBS containing 2% penicillin–streptomycin. Subcutaneous tissue was removed as clean as possible with sterilized ophthalmic scissors and tweezers. The digested foreskin was taken out and the epidermis and dermis were carefully separated after expanding the processed foreskin and putting it into a 37°Cincubator for digestion for 2 h within 0.5% dispase. The dermis was digested with 0.2% type I collagenase for 2 h in an incubator at 37°C then the digestion was terminated with complete medium and the dermal tissue digested was taken out. The fibroblasts were collected into a 50 ml centrifuge tube by twice supernate filtration using 200 mesh sterilization filters followed with a centrifugation at 1500 rpm for 5 min. The cells were re-suspended with the complete culture medium (DMEM containing 10% FBS), then placed in 25cm2 flasks (5%CO2, 37 °C). Cell adherence was observed under a microscope after 2 days and medium was changed to remove the cells without adherence. The eye-widening tissues were provided by the departments of burn plastic, Nanjing Drum Tower Hospital and fibroblasts were cultured according to above procedures.
Surface marker expressions of UC-MSCs and fibroblasts by flow cytometry (FCM)
The FCM (BD, USA) analysis was performed to assay the surface marker expressions of UC-MSCs and fibroblasts. The cells in 100 μL PBS (Hyclone, SH.30256.01, China) were incubated with anti-CD14 (BD, 555397, USA), CD19(BD, 555412, USA),CD34(BD, 555821, USA), CD45(BD, 560976, USA), CD73(BD, 550257, USA), CD90(BD, 555596, USA), CD105(BD, 560839, USA),and HLA-DR(BD, 555561, USA) antibodies conjugated with FITC or PE for 15 min in darkness. The cells were assayed by FCM and the original data were analyzed by Flowjo (V10).
Osteogenic, adipogenic, and chondrogenic differentiations
UC-MSCs and fibroblasts at P4 were digested and seeded on a six-well plate. The osteogenic differentiation and adipogenic differentiation mediums (Gibco, USA) were changed every 3 days to induce osteogenic and adipogenic differentiation, respectively. After 21 days, Alizarin red-S staining (Sigma-Aldrich, St. Louis, MO, USA) and Oil red O staining (Sigma-Aldrich, St. Louis, MO, USA) were used to stain the differentiated cells. Images were taken with a microscope (Olympus, Japan) and analyzed by Image J 1.52 software(National Institutes of Health, USA).The data were analyzed and visualized by GraphPad (Prism 5).
Cells were centrifuged at 200 g for 10 min and the supernatant was removed. Chondrogenic differentiation induction solution (Gibco, USA) was added into the experimental groups. The blank group was performed using complete medium. Then samples were placed in incubator (37 °C, 5% CO2) and medium was replaced every 3 days. On the 21st day, the samples were fixed by 4% paraformaldehyde for 1 h and O.C.T (SAKURA, USA) embedded sections were performed. After alcian blue staining, the images were observed under a microscope.
Immunofluorescence
Cells were spread into 12-well plates on glass cover-slides. When cell confluence reached to 70%, the supernatant was discarded and 4% paraformaldehyde was fixed for half an hour. Primary antibodies of α-SMA (Abcam, ab32575), S100A4 (Abcam, ab124805), and vimentin (Abcam, ab92547) were incubated at 4 °C overnight. Cells were washed for 3 times with PBS on the next day and incubated with corresponding second antibody at room temperature for 1 h. Cell slides were collected and sealed by DAPI solution (Abcam, ab104139).The images were observed under a confocal microscope (Leica, Germany).
Western blot
When cell confluence reached to 90%, UC-MSCs and fibroblasts were washed twice by PBS and then lysed using cold RIPA buffer (Beyotime P0013B) on ice for 15 min. Lysates of cells were cleared by centrifugation at 12,000 rpm for 25 min. Protein concentration of each sample was detected using the bicinchoninic acid assay (Beyotime, P0010). A total of 30 μg cell extract for each sample were resolved by SDS-PAGE, and then transferred to nitrocellulose membrane. The nitrocellulose membrane was probed with primary antibodies of α-SMA, S100A4, vimentin, and GAPDH (Service bio, GB11002). Final blots were detected using a supersensitive ECL system (Amersham).
Immunoregulatory capability in vitro
UC-MSCs and fibroblasts were co-cultured with PBMCs in 6-well or 12-well plates. Specific procedures were carried out referring to our previous study [43] aiming to detect their regulatory effects on Th1, Th17, and Treg cell differentiations in vitro.
RNA-seq
UC-MSCs and fibroblasts were digested for 3 min, then the cells were collected and counted as 2 × 106 per sample (n = 3). A total of 1 mL Trizol (Thermo) was added into each sample and sent to company for RNA separation and library preparation.
RNA-seq libraries (Tru-seq, Illumina) were prepared from UC-MSCs and HFFs in 3 biological replicates. Total RNAs were extracted using the mirVana miRNA Isolation Kit (Ambion) and RNA integrity was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Samples with RNA Integrity Number (RIN) ≥ 7 were subjected to the subsequent analysis. Libraries were sequenced on the Illumina HiSeq sequencing platform and 125 bp/150 bp paired-end reads were generated.
Raw data were first filtered by Trimmomatic software and obtained clean reads were mapped to GRCh38.p12 version of Homo Sapiens reference genomes using HISAT2. FPKM value of each gene was calculated via cufflinks, and the read counts of each gene were obtained by htseq-count. Library construction and up-stream data processing of RNA-seq data above were conducted by OE Biotech Co., Ltd (Shanghai, China).
Principal Component Analysis (PCA) and Spearman correlation analyses of replicates in 2 groups were performed by TBtools software based on FPKM values. Differential gene expression analysis was conducted via the DESeq (2012) R package using the cutoff of |log2FoldChange|> 2, q-value < 0.01 based on BaseMean values which calculated by the same R package. Results of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were obtained using online analysis tool Metascape after the input of certain gene sets. Protein–protein interaction network analysis was performed by another online tool STRING. In order to search for HFFs differentially expressed genes from another direction, we used a peak-calling tool, MACS2, to get significant clusters of HFFs reads, which was so-called peaks in this article, representing the high expression sites of HFFs replicates relative to the background UC-MSCs. The genome coordinates of those peaks of significance (p < 0.05) were then annotated by Homer software (hg38 genome). Only genes of those with significant peaks, significant clusters of mapped reads, and higher BaseMean level at the same time could be the most possible candidates of HFF-specific highly expressed genes for further analysis and research. We used Integrative Genomics Viewer (IGV) as the visual exploration tool for RNA-seq data.
Metabolomic analysis
The culture medium was replaced with basal culture medium when cells grew to 80–90% confluence. After 24 h, the supernatant was collected and lyophilized by lyophilizer (Christ, EPSILON 2-6D LSC Plus). Samples (n = 6) were dissolved by methanol (containing 0.1% formic acid) before testing. UC-MSCs and HFFs were digested and collected after being washed twice by pre-cooled PBS and washed once by normal saline (0.9% sodium chloride solution). Before testing, 50 μL of water was added to each tube to re-suspend cells, then 450 μL methanol was added into tube. After swirling for 1 min, standing for 5 min, and centrifuging at room temperature for 15 min, supernatant was stored for analysis.
Samples were loaded through a UPLC system (Nexeraultra-high performance liquid chromatography LC-30A, Shimadzu) with an auto sampler. A HSS T3 column (1.8 μm, 2.1 mm ID × 100 mm, Waters) was used. The mobile phase A was water (containing 20 mM ammonium acetate and 20 mM ammonium hydroxide) and phase B was acetonitrile. The LC separations were 14 min per sample using the following scheme: (1) 0 min, 5% phase B; (2) 9 min, 95%phaseB; (3) 10 min, 95% phase B, (4) 11 min, 5% phase B, (5) 14 min, 5% phase B. All the changes were linear and the flow rate was 0.35 mL/min.MS analysis was performed using a Waters XEVO G2-XS QTof with a mimic multiple reaction monitoring (mMRM) mode. Typical operating parameters were set as follows: capillary voltage − 2.5 kV, source temperature 120 °C, desolvation temperature 350 °C, cone gas 50 L/h, desolvation gas 800 L/h. Both the cone and desolvation gases were nitrogen. The data were analyzed by MetaboAnalyst.
Colitis model
After housed in SPF-level laboratory animal room, the 8-week-old female C57BL/6 mice (n = 8 per group) were fasted for 24 h, then were given enema (1:1 mixing of TNBS and anhydrous ethanol). Themodel mice were inverted for 3 min. After 6 h, model mice were treated with UC-MSCs and fibroblasts (1 × 106/mouse) through intraperitoneal injection, respectively. Control group was treated with equal volume of PBS. The survival and body weight were observed daily for five consecutive days. At day 5 after cell therapy, mice were euthanized. Colons were harvested and MPO was detected using the MPO kit (Nanjing Jiancheng, A044-1–1, China). The data were analyzed and visualized by GraphPad.
Hepatic fibrosis model
Female C57BL/6 mouse (8-week-old) was intraperitoneal administrated with 150 μL mixture of corn oil and CCL4 (corn oil: CCL4 = 3:1) (n = 8 per group), twice a week during an eight-week period. Sham group was administrated with equal volume of PBS, after eight weeks, mouse abdominal cavity was opened to confirm the success of constructing hepatic fibrosis model and orthotopic transplantation of UC-MSCs and HFFs (5 × 105 cells/mouse) was carried through our previously reported novel minimally invasive open-flow microperfusion (OFM) technique [44]. Mice in control group were administrated with equal volume of PBS. After another 3 weeks, the orbital blood samples of mice were collected and centrifuged at 3500 rpm for 8 min to obtain the serum for glutamic-pyruvic transaminase (ALT) detection. After orbital blood collection, the mice were euthanized and the liver tissues of mice were harvested and homogenized to detect procollagen type III (PCIII) and laminin (LN) by ELASE kits (Nanjing Jiancheng) according to the instructions of Kits.
Histopathology assays
Mice liver tissues were formalin-fixed and paraffin-embedded for hematoxylin and eosin (H&E) staining. Liver slices were fixed by 95% ethanol for 2-5 min after being washed with running water for 1 min.The slices were performed hematoxylin staining for 2–4 min and hydrochloric acid alcohol differentiation solution staining for 7 s. Then slices were put into ammonia water for 30 s and put into eosin solution for 7–10 s, then dehydrated by alcohol and permeabilized by xylene. After H&E staining, the slices were sealed by neutral resin for storage and observation.
For Masson staining, liver tissue slices firstly were dewaxed by xylene and alcohol and then corresponding steps were carried out according to the instructions of masson staining kit (Baso, BA4079A). Briefly, slices were treated by 1% glacial acetic acid for 1 min after staining and then dehydrated by alcohol and permeabilized by xylene. After sealed by neutral resin, images were captured by microscope.
For immunohistochemistry, the dewaxed liver sections were incubated with 3% hydrogen peroxide at room temperature for 15 min to remove endogenous peroxidase. After antigen retrieval, sections were blocked using 5% FBS at room temperature for 60 min and then incubated with primary α-SMA or collagen I antibody solution in a wet box at 4 °C overnight. The corresponding second antibody solution was incubated for 10 min at room temperature after washing with PBST. A volume of 50–100 μL DAB (Maxim, 2031) working solution was dropped onto the slices and color development was stopped in time by water under microscopic observation. After hematoxylin re-dying for 1–5 min, slices were dehydrated by alcohol and permeabilizedby xylene. Images were captured by microscope.
Q-PCR
Total RNAs of liver tissue samples were extracted using Trizol reagent. The concentration of RNAs was measured by nanodrop (Thermo). Reverse transcription kit (Vazyme, R323-01) was used for reverse transcription according to instructions. 2 μL cDNA, 10 μL mix, 0.4 μL upstream primers, 0.4 μL downstream primers, and 7.2 μL water were mixed and added to the 96-well plate per well. The original Q-PCR results, expressed as the number of cycles, were converted into relative expression data using delta-Delta Ct method. Q-PCR data were collected by QuantStudio™ real-time PCR software v1.1. The primers of GAPDH, TGF-β, α-SMA, collagen I, MMP9, and TIMP1were listed as below.
GAPDH forward primer (TCGTCCCGTAGACAAAATGG), reverse primer (GAGGTCAAT GAAGGGGTCGT), TGF-β forward primer (GGACTCTCCACCTGCAAGAC), reverse primer (CATAGATGGCGTTGTTGCGG), α-SMA forward primer (GAACACGGCATCATCACCAAC), reverse primer (CTCCAGAGTCCAGCACAATACC), collagen I forward primer (GCTC CTCTTAGGGGCCACT), reverse primer (CCACGTCTCACCATTGGGG), MMP9 forward primer (CGCCTTGGTGTAGCACAACA), reverse primer (ACAGGGTTTGCCTTCTCCGTT), TIMP1forward primer (CGAGACCACCTTATACCAGCG), reverse primer (ATGACTGGGG TGTAGGCGTA).
Immunoregulation assays in vivo
Spleens and mesenteric lymph nodes of mice were harvested and filtered after grinding, thensediments were re-suspended by 1 mL PBS after centrifugation. A total of 50 μL tissue homogenate were added to each well in 24-well plate and incubated with 500 μL 1640 culture medium at 37 °C for 5 h for detecting the Th1/Th17 and Tregs subsets according to above in vitro method.
After euthanizing the mice, we harvested the intestinal tracts from anus to cecum and then cleaned them 4—5 times with PBS after removing faeces. The intestines were expanded and divided into several sections as the size of soybean grains. Then, the intestines were transferred into a 50 ml centrifuge tube. Predigested liquid with RPMI1640 (Gibco, 61870036), 5 mM EDTA (Biosharp, BS107-100 g), 10 mM HEPES (Biosharp, BS106-100 g) were added to the tube. The shaker was used for digesting (37 °C, 150 rpm, 15 min). After filtering the liquid with to collect the tissues, the remaining intestinal tissues were cut into pieces and then added digestive solution containing RPMI1640, 1 mg/ml DNase (Roche, 10104159001), 1 g/ml mixed enzyme (Roche, 10269638001) at 37 °C, 150 rpm, 40 min. After filtrating with 100-mesh sieves, the cells centrifuged at 1500r for 5 min were lamina propria cells.
Cells were re-suspended by 400 μL PBS, we put 100 μL into a tube for FCM. CD4 + T cells were stained referring to the above methods of Th1, Th17, and Treg. Neutrophils were stained with CD45 (eBioscience, 17–0451-82), CD11b (eBioscience, 45–0112-82), Gr1 (BD, 553128) for 30 min at room temperature, then washed and put on the machine. Macrophages were stained with CD11b and F4/80 (eBioscience, 11–4801-85) for 30 min at room temperature first, then NOS2 (eBioscience, 12–5920-82) was used for 30 min at room temperature after fixing and permeabilizing.
Statistical analysis
GraphPad Prism 5 Software (San Diego, CA, USA) was used for statistical processing. Quantitative data were expressed as Mean ± Standard Deviation (SD). The inter-group comparison was performed by one-way ANOVA. A p < 0.05 was considered significant difference.
