Human PC tissues collection
All protocols were supported by the ethics committee of the First Affiliated Hospital of Zhengzhou University, and the informed consents obtained from all patients recruited in this study prior surgery. A total of 22 patients with pancreatic ductal adenocarcinomas diagnosed by pathological review were recruited in the study, and human PC specimens (n = 22) and their para-carcinoma tissues (n = 22) were collected from PC patients underwent cancer resection at the First Affiliated Hospital of Zhengzhou University. All patients were not treated with chemotherapy, Chinese medicine or radiotherapy before surgical resection. The characteristics of the patients were included in Additional file 1: Table S1. The collected tissues were placed in − 80 °C refrigerator until detection.
Cell culture
Human pancreatic ductal adenocarcinoma cell lines PANC-1 and BxPC-3, and normal human pancreatic duct epithelial cells HPDE6-C7 were purchased from American Type Culture Collection (ATCC, USA). PANC-1 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin–streptomycin (HyClone) with 5% CO2 at 37 °C. BxPC-3 cells were maintained in 1640-RPMI medium containing 10% FBS (Gibco) and 1% penicillin–streptomycin (HyClone) with 5% CO2 at 37 °C. HPDE6-C7 cells were cultured in keratinocyte serum free medium (K-SFM) containing bovine pituitary extract (5 mg/100 ml) and epidermal growth factor (EGF, 0.5 µg/100 ml, Invitrogen) with 5% CO2 at 37 °C.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from the tissues or cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA was reverse transcribed into cDNA using a miScript II RT Kit (Qiagen) for analysis of miR-32-5p expression, and the total RNA was applied in a cDNA Reverse Transcription Kit (Applied Biosystems) for detection of GAS5 and PTEN mRNA. The relative expression of miR-32-5p was determined by using SYBR Green-based miScript PCR Array (Qiagen) according to the manufacturer’s instructions and normalized to U6. The relative expression of GAS5 and PTEN mRNA was detected using SYBR Premix Ex Taq II (TaKaRa) and normalized to GAPDH. The specific primers for miR-32-5p (forward 5′-3′: CGGTATTGCACATTACTAAGTTGCA; reverse 5′-3′: CTCGCTTCGGCAGCACA), GAS5 (forward 5′-3′: AAGCCATTGGCACACAGGCATTAG; reverse 5′-3′: AGAACCATTAAGCTGGTCCAGGCA), PTEN (forward 5′-3′: ACCAGTGGCACTGTTGTTTCAC; reverse 5′-3′: TTCCTCTGGTCCTGGTATGAAG), U6 (forward 5′-3′: CTCGCTTCGGCAGCACA; reverse 5′-3′: AACGCTTCACGAATTTGCGT) and GAPDH (forward 5′-3′: ACAACTTTGGTATCGTGGAAGG; reverse 5′-3′: GCCATCACGCCACAGTTTC) were provided by Sangon Biotech (Shanghai) Co., Ltd. (China).
Western blotting
Western blotting was performed to detect the expression of PTEN protein in the tissues or cells. The cells were lysed in lysis buffer (Thermo Scientific) and then the protein was collected by centrifugation at 12,000 rpm for 10 min. The total protein of each sample was quantified by BCA Protein Assay Kit (Beyotime Biotechnology, No. P0011). Proteins were separated by SDS-PAGE and then were electroblotted to PVDF membrane (Millipore). The membrane was blocked with 5% skim milk in TBST for 1 h and the protein on membrane was then incubated with the specific primary antibody for PTEN (1:500; Cell Signaling Technology) or β-actin (1:1000; Abcam) overnight. The proteins were further incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 h. The protein bands were visualized using ECL chemiluminescence system (Thermo Fisher Scientific). β-actin was used as the control for PTEN protein.
Cell Counting Kit-8 assay
The relative cell viability was evaluated by Cell Counting Kit-8 assay, which is a widely used method for analysis of cell viability. In brief, PANC-1 and BxPC-3 cells were cultured in 96-well plates with 6 × 103 cells/well. CCK-8 solution (10 μl, Dojindo) was added in each well and incubated with the cells for 1 h. The absorbance at 450 nm was measured with a microplate reader (Bio-Rad). Each cell group duplicated into six wells and the experiment was repeated in triplicate.
Detection of migration and invasion with Transwell system
The transwell system (polycarbonate with 8 μm pore) (Corning) was used to measure the migration and invasion of PANC-1 and BxPC-3 cells. For migration, 2 × 104 cells cultured in serum-free medium were placed in the chambers without Matrigel. For invasion, 2 × 105 cells cultured in serum-free medium were placed in the chambers with Matrigel. The medium containing 10% FBS was added in the lower chamber. After incubation for 24 h at 37 °C with 5% CO2, the cells in the upper chamber were scraped off by medical cotton stickers, and the cells on the other side of the membrane were fixed by methanol and stained with 0.5% crystal violet for 2 h. The number of stained cells was counted on an inverted microscope with five random fields.
Flow cytometry analysis of apoptosis
After transfection, the apoptosis level of PANC-1 and BxPC-3 cells were analyzed using flow cytometry. The cells were collected and washed two times with PBS. Subsequently, the cells were stained by Annexin V-FITC and PI dye for 15 min in dark according to the manufacturer’s instructions. The stained cells were analyzed by flow cytometry (BD Biosciences) and were counted using the CellQuest software (BD Biosciences). This experiment was repeated three times.
Cell transfection
The pcDNA vector carrying GAS5 (pcDNA-GAS5) was constructed at Shanghai Genechem Co., Ltd. (China) to induce GAS5 in PC cells. The specific interference sequence (5-CTTGCCTGGACCAGCTTAATT-3) for GAS5 (siRNA-GAS5) was used to down-regulate the expression of GAS5. The commercial miR-32-5p inhibitor and mimic were purchased from GenePharma (China). PANC-1 and BxPC-3 cells were cultured in 24-well plates and transfected with pcDNA-GAS5 (2 µg) or siRNA-GAS5 or miR-32-5p inhibitor (150 nM) or mimic (100 nM) or the appropriate negative control using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions.
RNA immunoprecipitation (RIP) assay
The RIP assay was performed to explore the interaction between GAS5 and miR-32-5p by using EZ-Magna RIP RNA-binding protein immunoprecipitation kit (Millipore). PANC-1 cells were lysed, and the cell lysis was then incubated with anti-human Ago2 antibodies (Millipore) coated on magnetic beads in RIP buffer. Input and normal IgG were used as controls. The precipitated RNAs were isolated and reverse transcribed in cDNA to analyze GAS5 and miR-32-5p level using qRT-PCR.
RNA pull-down assay
GAS5 RNA was transcribed using T7 RNA polymerase (Roche) and biotin-labeled by using Biotin RNA Labeling Mix (Roche). The RNA pull-down assay was performed with the Magnetic RNA–Protein Pull-Down Kit (Thermo Fisher) according to the manufacturer’s instructions. Biotinylated GAS5 was incubated with streptavidin beads from kit at 4 °C overnight. The cell lysate was added, then hatching for 4 h sequentially at 4 °C. The beads were washed for three times. The level of Ago2 protein in the eluted complex was analyzed by western blotting, and the miR-32-5p level was determined by qRT-PCR according to the standard procedures.
Animal study
Twenty-four female athymic BALB/c nude mice (4–5 week old) were provided by the animal center of Zhengzhou University. The animal study was supported by the ethics committee of the First Affiliated Hospital of Zhengzhou University, and all protocols were performed under the guidelines of the experimental animal management of the First Affiliated Hospital of Zhengzhou University.
PANC-1 cells were transfected with pcDNA-GAS5 or pcDNA, the negative control for pcDNA-GAS5. The normal control or negative control or PANC-1 cells (5 × 106 cells) expressing GAS5 were used to induce subcutaneous tumors of mice (n = 6 in each group) by subcutaneous injection. The tumor volume was monitored weekly for 4 weeks and calculated using the formula, V (mm3) = 0.5 × L × W2 (V, volume; L, length; W, width). After the last measurement, the mice were executed, and all tumor tissues were dissected from the mice for analysis of the expression level of miR-32-5p and PTEN.
Statistical analysis
All data from at least three independent experiments were represented as the mean ± standard deviation (SD). Statistical analysis was performed using the SPSS 19.0 software (USA). Difference analysis was conducted by Bonferroni t test. P < 0.05 was considered significant.
