Skip to main content

Table 1 Primer sequences

From: Mettl14-mediated m6A modification modulates neuron apoptosis during the repair of spinal cord injury by regulating the transformation from pri‐mir‐375 to miR-375

Gene Sequence (5′-3′)
Mettl14 F: TTTCTCTGGTGTGGTTCTGG
R: AAGTCTTAGTCTTCCCAGGATTG
U6 F: CTCGCTTCGGCAGCACA
R: GTGTCGTGGAGTCGGCAA
miR-375 F: AAGCTTTGTTCGTTCGGCTC
R: GTATCCAGTGCGAATACCTC
RASD1 F: TGAGAAAAATGCCAAGCGCC
R: GGAGTCTTGAGGGGAGTGGA
GAPDH F: ACCAGGTATCTGCTG GTTG
R: TAACCATGATGTCAGCGTGGT