Skip to main content

Table 2 Primer

From: OTUB1-mediated deubiquitination of FOXM1 up-regulates ECT-2 to promote tumor progression in renal cell carcinoma

IDSequence (5′–3′)
GAPDH FACCACAGTCCATGCCATCAC
GAPDH RTCCACCACCCTGTTGCTGTA
OTUB1 FACAGAAGATCAAGGACCTCCA
OTUB1 RCAACTCCTTGCTGTCATCCA
FOXM1 FATACGTGGATTGAGGACCACT
FOXM1 RTCCAATGTCAAGTAGCGGTTG