Skip to main content

Table 2 Primer

From: OTUB1-mediated deubiquitination of FOXM1 up-regulates ECT-2 to promote tumor progression in renal cell carcinoma

ID Sequence (5′–3′)
GAPDH F ACCACAGTCCATGCCATCAC
GAPDH R TCCACCACCCTGTTGCTGTA
OTUB1 F ACAGAAGATCAAGGACCTCCA
OTUB1 R CAACTCCTTGCTGTCATCCA
FOXM1 F ATACGTGGATTGAGGACCACT
FOXM1 R TCCAATGTCAAGTAGCGGTTG