Skip to main content

Table 3 RT-qPCR primer sequences

From: CRISPRa-mediated FOXP3 gene upregulation in mammalian cells

Gene Forward (5′−> 3′) Reverse (5′−> 3′) RefSeq accession number
CD25 cgcagaataaaaagcgggtca acttgtttcgttgtgttccga NM_000417.2
dCas9 ggatcgaagagggcatcaaa gttcctggtccacgtacatatc KR011748.1
FOXP3 gcaccttcccaaatcccagt ggccacttgcagacacca NM_014009.3
GAPDH tgcaccaccaactgcttagc ggcatggactgtggtcatgag NM_002046.7
GITR ccagtgtatcgactgtgcctcg cacagcgttgtgggtcttgttc NM_004195.3
ICOS cccataggatgtgcagcctttg ggctgtgttcactgctctcatg NM_012092
IKZF2 acactctggagagaagccgttc ccagtgaactgcgctgcttgta NM_016260.3
IRF4 gaacgaggagaagagcatcttcc cgatgccttctcggaactttcc NM_002460.4
PI16 ctggtgtgcaactatgagcctc ggcaaatcctgagcatcttccg NM_153370.3
PTPRC cttcagtggtcccattgtggtg ccactttgttctcggcttccag NM_002838.5
TNFR2 cgttctccaacacgacttcatcc acgtgcagactgcatccatgct NM_001066.3