Skip to main content

Advertisement

TableĀ 1 Mouse qRT-PCR primer sets

From: Optogenetic stimulation inhibits the self-renewal of mouse embryonic stem cells

Gene Forward sequence Reverse sequence
Oct4 GTGGAGGAAGCCGACAACAATGA CAAGCTGATTGGCGATGTGAG
Sox2 CAGGAGAACCCCAAGATGCACAA AATCCGGGTGCTCCTTCATGTG
Esrrb CAGGCAAGGATGACAGACG GAGACAGCACGAAGGACTGC
Klf4 GTGCAGCTTGCAGCAGTAAC AGCGAGTTGGAAAGGATAAAGTC
Nanog TGGTCCCCACAGTTTGCCTAGTTC CAGGTCTTCAGAGGAAGGGCGA
Cdx2 AGGCTGAGCCATGAGGAGTA CGAGGTCCATAATTCCACTCA
Gata6 CTCAGGGGTAGGGGCATCA GAGGACAGACTGACACCTATGTA
Foxa2 CCCTACGCCAACATGAACTCG GTTCTGCCGGTAGAAAGGGA
Fgf5 CTGTATGGACCCACAGGGAGTAAC ATTAAGCTCCTGGGTCGCAAG
Nestin GCAGGGTCTACAGAGTCAGATCG CAGCAGAGTCCTGTATGTAGCCA
Gata2 GCCTGTGGCCTCTACTACAAGC CCCTTTCTTGCTCTTCTTGGAT
Hand1 AGGATGCACAAGCAGGTGA GAGGCAGGAGGGAAGCTTT
Brachyury GCTTCAAGGAGCTAACTAACGAG CCAGCAAGAAAGAGTACATGGC
Gapdh AGAGACGGCCGCATCTTCTTG TGAAGGGGTCGTTGATGGCA