Skip to main content

Advertisement

Table 1 Primers for real-time RT-PCR analysis

From: Metformin represses the pathophysiology of AAA by suppressing the activation of PI3K/AKT/mTOR/autophagy pathway in ApoE−/− mice

ID Sequence (5′–3′) Product length (bp)
Mouse
 β-actin F CATTGCTGACAGGATGCAGA 139
 β-actin R CTGCTGGAAGGTGGACAGTGA  
 PI3K F ACACCACGGTTTGGACTATGG 140
 PI3K R GGCTACAGTAGTGGGCTTGG  
 AKT F AGAAGAGACGATGGACTTCCG 111
 AKT R TCAAACTCGTTCATGGTCACAC  
 mTOR F CACCAGAATTGGCAGATTTGC 82
 mTOR R CTTGGACGCCATTTCCATGAC  
 LC3B F CGCTTGCAGCTCAATGCTAAC 93
 LC3B R CTCGTACACTTCGGAGATGGG  
 Beclin1 F ATGGAGGGGTCTAAGGCGTC 149
 Beclin1 R TGGGCTGTGGTAAGTAATGGA  
Rat
 GAPDH F CCTCGTCTCATAGACAAGATGGT 169
 GAPDH R GGGTAGAGTCATACTGGAACATG  
 PI3K F TTAACCCCCTCACAGCAGAG 251
 PI3K R TTTCTGAACTGCAATGGCCC  
 AKT F GCTGCTCAAGAAGGACCCTA 218
 AKT R CTTGATCAGGCGGTGTGATG  
 mTOR F GTTTGAAGTGAAGCGAGCCT 231
 mTOR R CGCTGCGTGGTAAGAATCAG  
 LC3B F TACCAAGGCAAAAAGGGACG 282
 LC3B R CCCCTGACACTGCTCTTCTAT  
 Beclin1 F GACCGAGTGACCATTCAGGA 200
 Beclin1 R TGGTCTTCACAGGGTGCTAC