Skip to main content

Table 1 Primer sequences for reverse transcription quantitative polymerase chain reaction

From: Cardioprotective effects of microRNA-18a on acute myocardial infarction by promoting cardiomyocyte autophagy and suppressing cellular senescence via brain derived neurotrophic factor

Gene Primer sequences (5′–3′)
miR-18a F: GCTGAGCTAAGGTGCATCTAG
R: TCAACTGGTGTCGTGGAGT
BDNF F: GCGCCCATGAAAGAAGCA
R: CACAGCTGGGTAGGCCAAGT
U6 F: TGCGGGTGCTCGCTTCGGCAGC
R: CCAGTGCAGGGTCCGAGGT
GAPDH F: GCAAGTTCAACGGCACAG
R: ACGCCAGTAGACTCCACGAC
  1. miR, microRNA; BDNF, brain derived neurotrophic factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward, R, reverse