Skip to main content

Advertisement

Table 1 Primers, amplicon size and annealing temperature of Tf, TfR, Ferritin, IRP1 and β-actin for RT-PCR

From: Mutant huntingtin induces iron overload via up-regulating IRP1 in Huntington’s disease

Name Primer sequences Amplicon size (bp) Annealing temperature (°C)
Forward Reverse
β-actin GTCGTACCACAGGCATTGTGATGG GCAATGCCTGGGTACATGGTGG 492 58/63
β-actin TTTCCAGCCTTCCTTCTTGGGTATG ATAGAGGTCTTTACGGATGTCAACG 100 58/63
Tf AAACGGTCAAATGGTGCG CTCCGACAGCTTACAGAAGAGC 413 58
TfR TCCCGAGGGTTATGTGGC GGCGGAAACTGAGTATGATTGA 324 58
Ferritin TTTGACCGAGATGATGTG TCAGTAGCCAGTTTGTGC 248 58
IRP1 GACATCGTGCTCACCATTACCAA TGAAATCTCGAAACATGCCTACA 265 58