Skip to main content

Advertisement

Table 1 Primers used in this study

From: Hepatitis B virus promotes cancer cell migration by downregulating miR-340-5p expression to induce STAT3 overexpression

Gene Primer sequences (5′–3′) forward (F), reverse (R) GenBank accession number Product length(bp)
GAPDH F: GAGAAGGCTGGGGCTCATTT NM_001289745 156
R: TAAGCAGTTGGTGGTGCAGG
STAT3 F: GAGGACTGAGCATCGAGCA NM_139276 85
R: CATGTGATCTGACACCCTGAA
STAT3-3′UTR F: ATCCGCTCGAGATGGCCCAATGGAATC NM_139276 2435
R: CGACGCGTGAGGTCAACTCCATGTCAAAG
STAT3-3′UTR-WT1+WT2 F: GCGCGCGCGGACTAGTTTTATAAATAGACTTATTTTCCT NM_139276 1191
R: CGACGCGTTTATAAACCACCTTATAGGTAGGTAAGC
STAT3-3′UTR-MUT1 F: GCGCGCGCGGACTAGTT CCGAT AATAGACTTATTTTCCT NM_139276 1191
R: CGACGCGTTTATAAACCACCTTATAGGTAGGTAAGC
STAT3-3′UTR-MUT2 F: GCGCGCGCGGACTAGTTTTATAAATAGACTTATTTTCCT NM_139276 1191
R: CGACGCGTAATAT AACCACCTTATAGGTAGGTAAGC
STAT3-3′UTR-MUT1+MUT2 F: GCGCGCGCGGACTAGTT CCGAT AATAGACTTATTTTCCT NM_139276 1191
R: CGACGCGTAATAT AACCACCTTATAGGTAGGTAAGC
  1. WT wild type, MUT mutation