Skip to main content

Advertisement

Table 1 Primers used for generation of recombinant VP19C-NESm/17-37BAC

From: Nuclear export of VP19C is not essential for replication of herpes simplex virus type 1

Primers Directiona Sequenceb
VP19C NESm forward CCGGCCGCAGAGCGGGCATTTGGGCGCGCACGGGCAACCAACACGATTCACGGCAC
  reverse GTTGGTTGCCCGTGCGCGCCCAAATGCCCGCTCTGCGGCCGGCTCCAACCCG
VP19C NESm/BAC forward GCGCGGGTTGGAGCCGGCCGCGGAGCGGGCGTTTGGGCGCGCCCGGGCCACCAACACGATTCACGGCAAGGATGACGACGATAAGTAGGG
  reverse CCGGGGGCGTCATGTCCTCGGTGCCGTGAATCGTGTTGGTGGCCCGGGCGCGCCCAAACGCCCGCTCCGCCAACCAATTAACCAATTCTGATTAG
BAC sequencing reverse TAACAACGGGGACGCTGACCG
  1. aDirectionality of the primer.
  2. bNucleotides in boldface type indicate priming sites within mutagenesis template plasmid pEP-KanS for amplification of KanR cassette.