Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study.

From: Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene

Primer name Primer sequence
Enosf1b full length forward ATGCTGGCGATCAAAATCATA
Enosf1b full length reverse CTGCTGTTTCTCAATGGCTCT
Enosf1b XhoI Kozak forward ATACTCGAGGACACCATGCTGGCGATCAAA
Enosf1b SacII reverse CTCGAGCCGCGGATTTTTCTGCTGTTTCTC
Exon 10 flanking forward GCCCTTGTGGAAGCTACTTG
Exon 10 flanking reverse GTGGGGCTTTTGAAGTGTTC