Skip to main content

Table 4 Primers used for Real-time RT-PCR

From: RNA sequencing profiles reveal dynamic signaling and glucose metabolic features during bone marrow mesenchymal stem cell senescence

Gene Forward primer sequence Reverse primer sequence
β-actin GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTTGCTG
P16INK4A AACACTTTCGGTCGTACCC GTCCTCGCAGTTCGAATC
Rb1 CATGCTAGCAGCTGTTCTTTAC AGTTTGCCTATATCAGCACAGT
ALDOA TGTTGTGGGCATTAAGGTAGA GAGGGACGAGGGAGTATGC
ENO1 CAAGTCCTTCATCAAGAACTATCC TGTCAGGTCATCTCCCACAAT
HK1 TCTAAACTCTGGGAAACAAAGGT GAAGTCAATCAGGATGTTACGG
HK2 GCCGTAGTGGACAAGATAAGAGAG GCCTCCATACCCATCTTGCTAC
LDHA TCCCTGAAGTCTCTGAACCCG TCCTCCTTGATTCCATAGAGACC
LDHB GGTGGTGGACAGTGCCTATGA GACTTCGTTCTCGATGCCGTA
PFKM GTGAAAGACCTGGTGGTTCAGA CTCTGAGATCTTGCCTTCCTTC
PK GAAACAGCCAAAGGGGACTA GGACTCCGTCAGAACTATCAAA
PGAM1 GAGCGACACTATGGGGGTCTAAC TCTGCGTACCTGCGGTCCTT
TPI1 CACTCTGAACGCAGCCAAGC CACCCAGGTAGCTCCTAAGTCC