Skip to main content

Table 1 Summary of the sequence of oligos/primers used in this paper

From: Rapid and robust derivation of mesenchymal stem cells from human pluripotent stem cells via temporal induction of neuralized ectoderm

Name Oligo sequences from 5' > 3' Name Oligo sequences from 5' > 3'
MIP247-Inter-F1 GGCAGAAGGGCAAGAGAAG MIP247-Inter-R1 CTCCCGCCATCTGTTGTTAG
MIP247-Inter-F2 GTGCCTGGCACCGCCATCAAT MIP247-Inter-R2 CGAGAAGCCGCTCCACATACAGT
MIP247-Inter-F3 GACGGCTGTGGCTGGAAGTTCG MIP247-Inter-R3 CCGCTTGGCCTCGTCGATGAA
MIP247-Inter-F4 GACAGGTGCCTCTGCGGCCAA MIP247-Inter-R4 CGTACGCCTTGGAGCCGTACA
HGPS-GT-F1 CTAGCGAGGGCCTATTTCCCATG pGl3.0-sgRNA-R TGTCTCGAGGTCGAGAATTC
Sox2-qRT-F AGCTACAGCATGATGCAGGA Sox2-qRT-R GGTCATGGAGTTGTACTGCA
Nanog-qRT-F TGAACCTCAGCTACAAACAG Nanog-qRT-R TGGTGGTAGGAAGAGTAAAG
Rex1-qRT-F TCGCTGAGCTGAAACAAATG Rex1-qRT-R CCCTTCTTGAAGGTTTACAC
Klf4-qRT-F TCTCAAGGCACACCTGCGAA Klf4-qRT-R TAGTGCCTGGTCAGTTCATC
Myc-qRT-F ACTCTGAGGAGGAACAAGAA Myc-qRT-R TGGAGACGTGGCACCTCTT
DNMT3B-qRT-F AAGCTACACACAGGACTTGACAG DNMT3B-qRT-R AGTTCGGACAGCTGGGCTTT
TERT-qRT-F TGTGCACCAACATCTACAAG TERT-qRT-R GCGTTCTTGGCTTTCAGGAT
GDF3-qRT-F AAATGTTTGTGTTGCGGTCA GDF3-qRT-R1 TCTGGCACAGGTGTCTTCAG
18 S-rRNA-qRT-F GTAACCCGTTGAACCCCATT 18 S-rRNA-qRT-R CCATCCAATCGGTAGTAGCG
GAPDH-qRT-F CAAAGTTGTCATGGATGACC GAPDH-qRT-R CCATGGAGAAGGCTGGGG
LaminB1-qRT-F GCTGCTCCTCAACTATGCTAAG LaminB1-qRT-R GAATTCAGTGCTGCTTCATATTCTC
LaminB2-qRT-F AGTTGGACGAGGTCAACAAGAG LaminB2-qRT-R GGACTCCAGGTCCTTCACAC
LC-qRT-F CTCAGTGACTGTGGTTGAGGA LC-qRT-R AGTGCAGGCTCGGCCTC
Progerin-qRT-F CTCAGTGACTGTGGTTGAGGA Progerin-qRT-R TTCTGGGGGCTCTGGGCT
hLA-Exon1-qRT-F1 AATGATCGCTTGGCGGTCTAC LA-Exon1-qRT-R1 CACCTCTTCAGACTCGGTGAT
LaminA-qRT-F1 CTGCTTCCAGGAAACTCCAC LaminA-qRT-R1 GCCAGGGCAGAAAAGCAGAAG
OCT4-BS-F1 TTGGGATGTGTAGAGTTTGAGA OCT4-BS-R1 TAAACCAAAACAATCCTTCTACTCC
AP2α-qRT-F1 ATTGACCTACAGTGCCCAGC AP2α-qRT-R1 ATGCTTTGGAAATTGACGGA
HNK1-qRT-F1 CGGAAGCAGGTTTGGAGA HNK1-qRT-R1 CGGAGACGCTCCGGACT
p75-qRT-F1 CAGGCTTTGCAGCACTCAC p75-qRT-R1 CTGCTGCTGTTGCTGCTTCT
PAX3-qRT-F1 GCATGTTCAGCTGGGAAATC PAX3-qRT-R1 ATGCTGTGTTTGGCCTTCTT
SOX10-qRT-F1 CTTTCTTGTGCTGCATACGG SOX10-qRT-R1 AGCTCAGCAAGACGCTGG
ZIC1-qRT-F1 CACGTGCATGTGCTTCTTG ZIC1-qRT-R1 GCGCTCCGAGAATTTAAAGA
SOX9-qRT-F1 AGCGAACGCACATCAAGAC SOX9-qRT-R1 CTGTAGGCGATCTGTTGGGG
p16-qRT-F1 CGGTCGGAGGCCGATCCAG p16-qRT-R1 GCGCCGTGGAGCAGCAGCAGCT
p21-qRT-F1 CCTGTCACTGTCTTGTACCCT p21-qRT-R1 GCGTTTGGAGTGGTAGAAATCT
IL1α-qRT-F1 GTGCTGCTGAAGGAGATGCCTGA IL1α-qRT-R1 CCCCTGCCAAGCACACCCAGTA
IL1β-qRT-F1 TGCACGCTCCGGGACTCACA IL1β-qRT-R1 CATGGAGAACACCACTTGTTGCTCC
IL6-qRT-F1 CCAGGAGCCCAGCTATGAAC IL6-qRT-R1 CCCAGGGAGAAGGCAACTG
IL8-qRT-F1 GAGTGGACCACACTGCGCCA IL8-qRT-R1 TCCACAACCCTCTGCACCCAGT
PAI-1-qRT-F1 CCTGGCCTCAGACTTCGGGGT PAI-1-qRT-R1 GGGGCCATGCCCTTGTCATCAAT