Skip to main content

Table 1 Primers for genotyping

From: Loss of signal transducer and activator of transcription 3 impaired the osteogenesis of mesenchymal progenitor cells in vivo and in vitro

Gene Forward Reverse
Prx1-cre GCGGTCTGGCAGTAAAAACTATC GTGAAACAGCATTGCTGTCACTT
Stat3 TTGACCTGTGCTCCTACAAAAA CCCTAGATTAGGCCAGCACA