Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: Semaphorin3A increases M1-like microglia and retinal ganglion cell apoptosis after optic nerve injury

Gene Forward (5’ -3’) Reverse (5’ -3’ )
Sema3A TGGGATTGCCTGTCTTTT GGCCAAGCCATTAAAAGTGA
Nrp1 GACAAATGTGGCGGGACCATA TGGATTAGCCATTCACACTTCTC
PlexinA GAATGCAAATGGGCTGGAAAAG GATAGCGAAGTCCCGTCCCA
CD86 ACTTACGGAAGCACCCACG CTTTGTAAATGGGCACGGC
IL-1-β ACGGACCCCAAAAGATGAAG AGGCCACAGGTATTTTGTCG
IL-6 ATACCACTCCCAACAGACC TGCATCATCGTTGTTCATAC
iNOS GCCACGGACGAGACGGATAG GGGCACATGCAAGGAAGGG
TNF-α CCTCTTCTCATTCCTGCTTG TCTGGGCCATAGAACTGATG
CD206 CCACGGATGACCTGTGCTC GGTTCCACACCAGAGCCATC
Arg1 CAACACTCCCCTGACAACC ACGATGTCTTTGGCAGATATG
IL-10 AGCCGGGAAGACAATAACTG GGAGTCGGTTAGCAGTATGTTG
Ym1 TGCGTGACTATGAAGCATTG TGACGGTTCTGAGGAGTAGAG
Actin TTCTACAATGAGCTGCGTGTG CCATCACAATGCCTGTGGT