Skip to main content

Table 7 Primer sequences for RT-qPCR

From: The crosstalk of HDAC3, microRNA-18a and ADRB3 in the progression of heart failure

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
miR-18a TAAGGTGCATCTAGTGCAGATAG GCGAGCACAGAATTAATACGAC
ADRB3 CGCCTTCAACCCGGTCATCTACTG GGTGGACTCTGCCTGGCTTCAAC
HDAC3 GACATGTGCCGCTTCCATTC CTGGCTGGAAAAGGTGCTTG
U6 GCATGACGTCTGCTTTGGA CCACAATCATTCTGCCATCA
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA