Skip to main content

Table 1 Stem-loop RT and RT-quantitative polymerase chain reaction primer sequences

From: Lrp4 in hippocampal astrocytes serves as a negative feedback factor in seizures

Gene Sequence (5′ → 3′)
U6 (F) CTCGCTTCGGCAGCACA
U6 (R) AACGCTTCACGAATTTGCGT
mmu-miR-125a-5p (RT) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAGGT
mmu-miR-351-5p (RT) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGCTCA
mmu-miR-6367 (RT) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCTGAAC
mmu-miR-125b-5p (RT) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAAGT
mmu-miR-6394 (RT) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGACCTGG
mmu-miR-125a-5p (F) CGCGTTCCCTGAGACCCTTTA
mmu-miR-351-5p (F) CGTTCCCTGAGGAGCCCTT
mmu-miR-6367 (F) AGCGTTCCCTGAGACCCTG
mmu-miR-125b-5p (F) CGCGTTCCCTGAGACCCTA
mmu-miR-6394 (F) AGCGTTCCCTGAGTGGGG
General mmu-miR (R) ATCCAGTGCAGGGTCCGAGG
  1. RT reverse transcription, mmu-miR mus musculus microRNA, F forward, R reverse