Skip to main content

Table 1 Primers sequences for qPCR

From: Biological properties of bone marrow stem cells and adipose-derived stem cells derived from T2DM rats: a comparative study

Gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
β-actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA
RUNX2 CCATAACGGTCTTCACAAATCCT TCTGTCTGTGCCTTCTTGGTTC
ALP CCTTGTAGCCAGGCCCATTG GGACCATTCCCACGTCTTCAC
COL1 GCCTCCCAGAACATCACCTA GCAGGGACTTCTTGAGGTTG
BMP CAACACCGTGCTCAGCTTC C TTCCCACTCATTTCTGAAAGTTCC
  1. RUNX2 runt-related transcription factor 2, ALP alkaline phosphatase, COL1 collagen type I, BMP bone morphogenetic protein