Skip to main content

Table 1 Primers, amplicon size and annealing temperature of ZnT3, Sp1 and β-actin for RT-PCR and ChIP-PCR

From: Disruption of zinc transporter ZnT3 transcriptional activity and synaptic vesicular zinc in the brain of Huntington’s disease transgenic mouse

Name Primer sequences Amplicon size (bp) Annealing temperature
Forward Reverse
β-actin GTCGTACCACAGGCATTGTGATGG GCAATGCCTGGGTACATGGTGG 492 58/63 °C
β-actin TTTCCAGCCTTCCTTCTTGGGTATG ATAGAGGTCTTTACGGATGTCAACG 100 58/63 °C
ZnT3 GGAGGTGGTTGGTGGGTATTTAGC CCATTAGCAGATTGGCACAGACAGC 317 58 °C
Sp1 AGAACCCACAAGCCCAGACAATC CTCCTTCTCCACCTGCTGTCTCA 330 63 °C
ZnT3 promoter -338 ~ -232(GC-1) GTCGTACCACAGGCATTGTGATGG GCAATGCCTGGGTACATGGTGG 106 60 °C
ZnT3 promoter -253 ~ -112(GC-2) TTTCCAGCCTTCCTTCTTGGGTATG ATAGAGGTCTTTACGGATGTCAACG 141 60 °C