Skip to main content

Table 1 Primers and siRNA sequences

From: MicroRNA let-7b inhibits cell proliferation via upregulation of p21 in hepatocellular carcinoma

Name Primer sequence
β-actin F 5′-CAGCAAGCAGGAGTATGACG-3′
β-actin R 5′-GAAAGGGTGTAACGCAACTAA-3′
U6 F 5′-GTGCTCGCTTCGGCAGCACATATAC-3′
U6 R 5′-AAAAATATGGAACGCTCACGAATTTG-3′
p21 F 5′-AAACTAGGCGGTTGAATGAG-3′
p21 R 5′-AAAGGAGAACACGGGATGAG-3′
P21 siRNA (sense) 5′-GACCAUGUGGACCUGUCACdTdT-3′
P21 siRNA (antisense) 5′-GUGACAGGUCCACAUGGUCdTdT-3′
NC siRNA (sense) 5′-AAUUCUCCGAACGUGUCACdTdT-3′
NC siRNA (antisense) 5′-GUGACACGUUCGGAGAAUUdTdT-3′
Let-7b mimics 5′-UGAGGUAGUAGGUUGUGUGGUU-3′
NC mimics 5′-UUGUACUACACAAAAGUACUG-3′
Let-7b F 5′-GTACTGAGGTAGTAGGTTGT-3′
Let-7b R 5′-GTGCAGGGTCCGAGGT-3′
Anti-Let-7b 5′-ACACGAATTCAACCACACAACCTACTACCTCATATACAACCACACAACCTACTACCTCAACATCAACCACACAACCTACTACCTCATCTTCAAACCACACAACCTACTACCTCAGGATCCACAC-3′