Skip to main content

Table 1 List of EGFR primer sequences used in the study

From: HCC-derived EGFR mutants are functioning, EGF-dependent, and erlotinib-resistant

EGFR mutationPrimer sequences
K757E
 Forward primer5’CATCTCCGAAAGCCAACGAGGAAATCCTCGATGAAG3’
 Reverse primer5’CTTCATCGAGGATTTCCTCGTTGGCTTTCGGAGATG3’
N808S
 Forward primer5’GGGAACACAAAGACAGTATTGGCTCCCAGTAC3’
 Reverse primer5’GTACTGGGAGCCAATAC TGTCTTTGTGTTCCC3’
R831C
 Forward primer5’CTACTTGGAGGACTGTCGCTTGGTGCAC3’
 Reverse primer5’GTGCACCAAGCGACAGTCCTCCAAGTAG3’
V897A
 Forward primer5’CACCAGAGTGATGCCTGGAGCTACG3’
 Reverse primer5’CGTAGCTCCAGGCATCACTCTGGTG3’
P937L
 Forward primer5’CCTCCCTCAGCCACTCATATGTACCATCG3’
 Reverse primer5’CGATGGTACATATGAGTGGCTGAGGGAGG3’
T940A
 Forward primer5’CTCAGCCACCCATATGTGCCATCGATGTCTACATG3’
 Reverse primer5’CATGTAGACATCGATGGCACATATGGGTGGCTGAG3’
M947T
 Forward primer5’CGATGTCTACATGATCACGGTCAAGTGCTGGATG3’
 Reverse primer5’CATCCAGCACTTGACCGTGATCATGTAGACATCG3’