Skip to main content

Advertisement

Table 2 Real time-PCR primers

From: Long noncoding RNA TANCR promotes γδ T cells activation by regulating TRAIL expression in cis

NameSequence
GAPDH-forwardGAGTCAACGGATTTGGTCGT
GAPDH-reverseTTGATTTTGGAGGGATCTCG
TRAIL-forwardCAAGCCCCATCAAGGACTGG
TRAIL-reverseGAAGGTAGCGTGTGGGGATT
TANCR-forwardTCTTGGCCTCCAAATTGTCACT
TANCR-reverseTCAAACTTCCCAAGTGTGCTT
U6-forwardCTCGCTTCGGCAGCACATATACT
U6-reverseACGCTTCACGAATTTGCGTGTC
Cas9-forwardCATCGAGCAGATCAGCGAGT
Cas9-reverseCGATCCGTGTCTCGTACAGG