Skip to main content

Advertisement

Table 2 sgRNA target sequences

From: CRISPRa-mediated FOXP3 gene upregulation in mammalian cells

Target genesgRNA target sequence
CTLA4cgacgtaacagctaaaccca
GATA3ccgcagagggcggccgccgg
GATA1gcgaggtccaagaatcccca
EOS (IKZF4)gcataccagacacataggag
RELAgccccgccgccgcccggcgc
RELCtcgcgcgcgcggcggccgcg
LEF1tccttggctgcccgctggag
IRF4cgctctccgggcgcggcgcg