Skip to main content

Table 2 sgRNA target sequences

From: CRISPRa-mediated FOXP3 gene upregulation in mammalian cells

Target gene sgRNA target sequence
CTLA4 cgacgtaacagctaaaccca
GATA3 ccgcagagggcggccgccgg
GATA1 gcgaggtccaagaatcccca
EOS (IKZF4) gcataccagacacataggag
RELA gccccgccgccgcccggcgc
RELC tcgcgcgcgcggcggccgcg
LEF1 tccttggctgcccgctggag
IRF4 cgctctccgggcgcggcgcg