Skip to main content

Advertisement

Table 1 sgRNA target sequences used for FOXP3 gene upregulation

From: CRISPRa-mediated FOXP3 gene upregulation in mammalian cells

Regulatory regionsgRNA target sequencesgRNA
CoretgtgtgcgctgataatcacgFox1
tgcttgaactacccggcgagFox2
cattgcttgaactacccggcFox3
tatagatggaattgatatggFox4
CNS1atagggcttggggtgacgctFox5
aaaatcacacatagggcttgFox6
gtacccacactcttaacctcFox7
agacagtctggctccagtacFox8
CNS2tcatggcggccggatgcgccFox9
cagattatgttttcatatcgFox10
gatgcgccgggcttcatcgaFox11
caccccacaggtttcgttccFox12
CNS3aggtcggcacctgtaggtccFox13
agacagggattgggaggtcgFox14
cagtaaaggtcggcacctgtFox15
taacagatgtcacggcatgtFox16
Cage1caagactggcttcagacctgFox17
aaccttctaagccctcgtaaFox18
caccattagttcaaaacaaaFox19
ctcctgcgtaattataaaccFox20
Cage 2tataggaggcaaacgaagtgFox21
gcgtaattataaaccaggccFox22
tgcagacttgggtcggaatgFox23
tacacctcctgcgtaattatFox24