Skip to main content

Table 1 sgRNA target sequences used for FOXP3 gene upregulation

From: CRISPRa-mediated FOXP3 gene upregulation in mammalian cells

Regulatory region sgRNA target sequence sgRNA
Core tgtgtgcgctgataatcacg Fox1
tgcttgaactacccggcgag Fox2
cattgcttgaactacccggc Fox3
tatagatggaattgatatgg Fox4
CNS1 atagggcttggggtgacgct Fox5
aaaatcacacatagggcttg Fox6
gtacccacactcttaacctc Fox7
agacagtctggctccagtac Fox8
CNS2 tcatggcggccggatgcgcc Fox9
cagattatgttttcatatcg Fox10
gatgcgccgggcttcatcga Fox11
caccccacaggtttcgttcc Fox12
CNS3 aggtcggcacctgtaggtcc Fox13
agacagggattgggaggtcg Fox14
cagtaaaggtcggcacctgt Fox15
taacagatgtcacggcatgt Fox16
Cage1 caagactggcttcagacctg Fox17
aaccttctaagccctcgtaa Fox18
caccattagttcaaaacaaa Fox19
ctcctgcgtaattataaacc Fox20
Cage 2 tataggaggcaaacgaagtg Fox21
gcgtaattataaaccaggcc Fox22
tgcagacttgggtcggaatg Fox23
tacacctcctgcgtaattat Fox24