Skip to main content

Advertisement

Table 1 Primer sequence for real-time polymerase chain reaction

From: BabaoDan attenuates high-fat diet-induced non-alcoholic fatty liver disease via activation of AMPK signaling

Gene Primer sequence
ACC
 F CCGTTGGCCAAAACTCTGGAGCTAA
 R GAGCTGACGGAGGCTGGTGACA
LXR-α
 F CTCAATGCCTGATGTTTCTCCT
 R TCCAACCCTATCCCTAAAGCAA
SCD-1
 F CGGTCATCCCATCGCCTGCTCT
 R GTAGGCGAGTGGCGGAACTGC
SREBP1-c
 F GTGAGGCGGCTCTGGAACAGAC
 R ATAGGGGGCGTCAAACAGGCC
CD36
 F CACAGCTGCCTTCTGAAATGTGTGG
 R TTTCTACGTGGCCCGGTTCTAATTC
PPARα
 F ACTGGTAGTCTGCAAAACCAAA
 R AGAGCCCCATCTGTCCTCTC
CPT-1
 F TCTAGGCAATGCCGTTCAC
 R GAGCACATGGGCACCATAC
GAPDH
 F ACCCCAGCAAGGACACTGAGCAAG
 R GGCCCCTCCTGTTATTATTATGGGGGT