Skip to main content

Advertisement

Table 1 Primers used for qRT-PCR

From: X-linked inhibitor of apoptosis protein accelerates migration by inducing epithelial–mesenchymal transition through TGF-β signaling pathway in esophageal cancer cells

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
XIAP AATAGTGCCACGCAGTCTACA CAGATGGCCTGTCTAAGGCAA
Ecadherin ATTTTTCCCTCGACACCCGAT TCCCAGGCGTAGACCAAGA
Ncadherin AGCCAACCTTAACTGAGGAGT GGCAAGTTGATTGGAGGGATG
TGF-β CAATTCCTGGCGATACCTCAG GCACAACTCCGGTGACATCAA
Vimentin AGTCCACTGAGTACCGGAGAC CATTTCACGCATCTGGCGTTC
GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC