Skip to main content

Advertisement

Table 1 Sequences of primers used for real-time PCR

From: Label-free quantitative proteomics identifies transforming growth factor β1 (TGF-β1) as an inhibitor of adipogenic transformation in OP9-DL1 cells and primary thymic stromal cells

Gene symbol Sequence (5′-3′)
PPARγ
 Forward TTTTCCGAAGAACCATCCGATT
 Reverse ATGGCATTGTGAGACATCCCC
FABP4
 Forward TGAAATCACCGCAGACGACA
 Reverse ACACATTCCACCACCAGCTT
β-catenin
 Forward CCGTTCGCCTTCATTATGGA
 Reverse GGCAAGGTTTCGAATCAATCC
Fzd2
 Forward TCATCTTTCTGTCCGGCTGCTACA
 Reverse AGCTGGCCATGCTGAAGAAGTAGA
Dvl1
 Forward ATGAGGAGGACAATACGAGCC
 Reverse GCATTTGTGCTTCCGAACTAGC
Dvl3
 Forward GTCACCTTGGCGGACTTTAAG
 Reverse AAGCAGGGTAGCTTGGCATTG
Axin2
 Forward CGCCAACGACAGCGAGTT
 Reverse CGGTAAGGAGGGACTCCATCTA
CCND1
 Forward CTCTAGTGGTCTCATGGCGT
 Reverse TTTCATCCCTACCGCTGTGT
LEF1
 Forward CCCTACCCATCCTCACTGTC
 Reverse ATAGCTGGATGAGGGATGCC
GAPDH
 Forward CGGTAAGGAGGGACTCCATCTA
 Reverse TTGCTGTTGAAGTCGCAGGAG