Skip to main content

Advertisement

Table 1 Primer sequence for sgRNA cloning

From: Functional characterization of SLC26A3 c.392C>G (p.P131R) mutation in intestinal barrier function using CRISPR/CAS9-created cell models

Primer name Primer sequence, 5′–3′
Human sgRNA1_T CACCGAATTAACAGTGGGTGAATCG
Human sgRNA1_B AAACCGATTCACCCACTGTTAATT
Human sgRNA2_T CACCGCCGATTCTGAGTATGATGGT
Human sgRNA2_B AAACACCATCATACTCAGAATCGG
Human sgRNA1a_T CACCGATAAGACCATATAAAATGAC
Human sgRNA1a_B AAACGTCATTTTATATGGTCTTAT
mouse sgRNA1_t CACCGAGATAACCAGAGGTAAATGC
mouse sgRNA1_b AAACGCATTTACCTCTGGTTATCT
mouse sgRNA2_t CACCGCCAGTTCTGAGTATGATGGT
mouse sgRNA2_b AAACACCATCATACTCAGAACTGG
Human ssODN GAAACTGCTCCTGAAACTGCTAGTCCCACCATCATACTCAGAATCCGAAACGGACCTAATTAACAGTGGGTGAATCGTCGTCAGTATATGCCTCTCTAAAGCAC
Human ssODN-a GAAACTGCTCCTGAAACTGCTAGTCCCACCATCATACTCAGGATAGGCAACGGACCTAATTAACAGTGGGTGAATCGTCGTCAGTATATGCCTCTCTAAAGCACATTGTCTTTCAACCACAGAATAAGACCATATAAAATGACTCGCAAGGCTGGGCGTGGTGGCTCACG
mouse ssODN GTAACGACAACTCCCACCATCATACTCAGAACTCGAAATGGACCTAGATAACCAGAGGTAAATGCTCGTCAGTAGGTGCCTCCCTACGCCCG