Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR

From: Modulation of lipolysis and glycolysis pathways in cancer stem cells changed multipotentiality and differentiation capacity toward endothelial lineage

Gene Sequences (5′-3′) Annealing Temp (oC) Amplicon length (bp)
Vimentin F: CAGATTGGCTGAAATGGATGAGAA R: TAGGTGGCGATGTCAATGTCAA 62 173
ZEB1 F: CTGGAGAAAAGCCCTATCAATGT R: CTGTCAACATCCTGGTCCCTTGT 62 244
Snail F: GAGTTTAAATTCCAGCTGCC R: CAGAGTCCCAGATGAGCATT 62 109
VE-cadherin F: TGAAGAATTACGAGTCGGAC R: CACAGTCGGATGTGTCGGTGC 65 129
18S RNA F: TCGGCTGGAGAAGAGCTACG R- GTACTTTCGTGGATGTTACA 57 131