Skip to main content

Table 2 Primers used for qRT-PCR

From: Critical role of Tim-3 mediated autophagy in chronic stress induced immunosuppression

Gene Forward primer sequence
(5′–3′)
Reverse primer sequence
(5′–3′)
Tim-3 TGCAGGAGCAGTCAGGATTC GCTGCTGGCTGTTGACGTAG
GAPDH GCGACTTCAACAGCAACTCCC CACCCTGTTGCTGTAGCCGTA