Skip to main content

Advertisement

Table 1 Primer sequence used in qPCR assays

From: Transmembrane protein 108 involves in adult neurogenesis in the hippocampal dentate gyrus

Gene name Forward primer sequence (5′–> 3′) Reverse primer sequence (5′–> 3′)
Tmem108 CCTGAGCTACTGGAACAATGCC CAGTGTCTCGATAGTCGCCATTG
Gapdh CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG
β-Actin CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG
Disc1 TGGTCGAGGATGGCGATTACGA AGAGCAGGTTGCTGTGAAGGCA
β-Catenin GTTCGCCTTCATTATGGACTGCC ATAGCACCCTGTTCCCGCAAAG
Apc GTGGACTGTGAGATGTATGGGC CACAAGTGCTCTCATGCAGCCT
Gsk3β GAGCCACTGATTACACGTCCAG CCAACTGATCCACACCACTGTC
PI3K CAAACCACCCAAGCCCACTACT CCATCAGCAGTGTCTCGGAGTT
Axin1 GTCCAGTGATGCTGACACGCTA GCCCATTGACTTGGATACTCTCC
Axin2 ATGGAGTCCCTCCTTACCGCAT GTTCCACAGGCGTCATCTCCTT