Skip to main content

Advertisement

Table 1 Primers used in this study

From: Polysialic acid is released by human umbilical vein endothelial cells (HUVEC) in vitro

Gene Accession No. Sense primer (5′–3′) Antisense primer (5′–3′) Amplicon length (bp)
Semiquantitative qPCR
 GAPDH NM_002046 AGTCAACGGATTTGGTCGTA ACCATGTAGTTGAGGTCAATGAAG 111
 ST8SiaII XM_017022642 CCAGCTGTTGTTGACAGAAGTAA TAAAATCTGCTTCCTGATCCTC 111
 ST8SiaIV XM_011543630 CTTCCAGCACAATGTAGAAGGTTG GCTCTTGACCACTGACACATCTC 112
Fluorescence-based RT-qPCR
 GAPDH NM_002046 AAGATGCGGCTGACTGTCG GTGACCAGGCGCCCAATAC 113
 ACTB NM_001101 TCCTGTGGCATCCACGAAACTA CGGCAATGCCAGGGTACA 121
 EEF1A1 NM_001402 AAAATGGGAAAGGAAAAGACTCA GGGGCATCAATGATAGTCACA 281
 ST8SiaII XM_017022642 GGAGGCAGAGGTACAATCAGATCA TTCTGTCAACAACAGCTGGTGAT 106
 ST8SiaIV XM_011543630 TTGTCTTTGAGTCGGTCACTTGT TCTAGGACCAAAGAGGAATTGATT 116