Skip to main content

Advertisement

Table 1 Primers used for qRT-PCR

From: MicroRNA-29a-3p enhances dental implant osseointegration of hyperlipidemic rats via suppressing dishevelled 2 and frizzled 4

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
ALP TGAGCGACACGGACAAGAAG GCCTGGTAGTTGTTGTGAGCAT
Runx2 CACAAGTGCGGTGCAAACTT AATGACTCGGTTGGTCTCGG
Dvl2 TCCACCATTACCCCCTTTGC GCCATGCTCACTGCTGTCT
Fzd4 GGAAGGACCAGGTGACGAAG GGAATATGATGGGGCGCTCA
GAPDH TGATGGGTGTGAACCACGAG CTGATGGGTGTGAACCACGAG
miR-29a-3p UAACCGAUUUCAAAUGGUGCUA