Skip to main content

Advertisement

Table 1 Related primer sequences of qRT-PCR

From: Correlation between hepatic human males absent on the first (hMOF) and viral persistence in chronic hepatitis B patients

Gene Related primer sequences
hMOF-forward primer GAAGGAGCATGAGGCGATCA
hMOF-reverse primer TTTCGTAGTTCCCGATGTGGAT
GAPDH-forward primer ATCACTGCCACCCAGAAGAC
GAPDH-reverse primer ATGAGGTCCACCACCCTGTT