Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Related primer sequences of qRT-PCR

From: Correlation between hepatic human males absent on the first (hMOF) and viral persistence in chronic hepatitis B patients

Gene Related primer sequences
hMOF-forward primer GAAGGAGCATGAGGCGATCA
hMOF-reverse primer TTTCGTAGTTCCCGATGTGGAT
GAPDH-forward primer ATCACTGCCACCCAGAAGAC
GAPDH-reverse primer ATGAGGTCCACCACCCTGTT