Skip to main content

Advertisement

Table 1 Primer sequences used in MSP

From: Epigenetic alterations in TRAMP mice: epigenome DNA methylation profiling using MeDIP-seq

Gene name Primer name Primer sequence Band size (bp)
Dync1i1 Dync1i1-MF TATGAAGAAAAATATAGTAAGATACGG 232
Dync1i1-MR ACGAACATTTCACATTTCGAA
Dync1i1-UF TTTATGAAGAAAAATATAGTAAGATATGG 235
Dync1i1-UR CACAAACATTTCACATTTCAAA
Slc1a4 Slc1a4-MF ATAAATTATTTTTTTTATGTTACGG 216
Slc1a4-MR TTAATAATACATACCTATAATCCGAC
Slc1a4-UF ATAAATTATTTTTTTTATGTTATGG 216
Slc1a4-UR TTAATAATACATACCTATAATCCAAC
Xrcc6bp1 Xrcc6bp1-MF GTTAATGTGAGAGTTAGAATAGTATAGGAC 110
Xrcc6bp1-MR AATTAATACAATATTTCGATACCGAT
Xrcc6bp1-UF GTTAATGTGAGAGTTAGAATAGTATAGGAT 110
Xrcc6bp1-UR AATTAATACAATATTTCAATACCAAT
TTR TTR-MF GGAATTTAAGATACGGTTTATATCGA 106
TTR-MR AACACTCTTTCGAACATACTCGAC
TTR-UF AGGAATTTAAGATATGGTTTATATTGA 108
TTR-UR AAACACTCTTTCAAACATACTCAAC
  1. Primer sequences are started from 5′ (left) to 3′ (right)
  2. MF forward primer sequence for the methylated reactions, MR reverse primer sequence for the methylated reactions, UF forward primer sequence for the unmethylated reactions, UR reverse primer sequence for the unmethylated reactions