Skip to main content

Advertisement

Table 1 Primers used in this study

From: The cathepsin S cysteine proteinase of the burrowing nematode Radopholus similis is essential for the reproduction and invasion

Primer name Sequence Primer use
Rs-cps-S1 5′-AGTGCCCCTCCGAAATGT-3′ RT-PCR
Rs-cps-A1 5′-TGTCCGTTCTTCCGTTCA-3′
SF 5′-TGTTGGCGGTCCCTGTG-3′ Southern blot
SR 5′-CGTGTTCGTGGACGGAGTT-3′  
Ish-T7S1a 5′-GGATCCTAATACGACTCACTATAGGGTGTTGGCGGTCCCTGTG-3′ ISH template
Ish-A1 5′- CCGTTCTCCTCGATGTAGTCA -3′
Ish-S2 5′-TGTTGGCGGTCCCTGTG-3′ ISH template
Ish-T7A2a 5′-GGATCCTAATACGACTCACTATAGGGCCGTTCTCCTCGATGTAGTCA-3′
qPCR-F 5′-AGAACTCCGTCCACGAACAC-3′ qPCR
qPCR-A 5′-GCCCACATTGCGCTTGCT-3′
Actin-F 5′-GAAAGAGGGCCGGAAGAG-3′ qPCR
Actin-R 5′-AGATCGTCCGCGACATAAAG-3′
CPS-T7Sa 5′-GGATCCTAATACGACTCACTATAGGGTGTTGGCGGTCCCTGTG-3′ dsRNA template
CPS-A 5′- CGTGTTCGTGGACGGAGTT-3′
CPS-S 5′-TGTTGGCGGTCCCTGTG-3′ dsRNA template
CPS-T7Aa 5′-GGATCCTAATACGACTCACTATAGGG CGTGTTCGTGGACGGAGTT-3′
eGFP-T7Sa 5′-GGATCCTAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTACC-3′ dsRNA template
eGFP-A 5′-AGTTCACCTTGATGCCGTTCTT-3′
eGFP-S 5′-CAGTGCTTCAGCCGCTACC-3′ dsRNA template
eGFP-T7 Aa 5′-GGATCCTAATACGACTCACTATAGGGAGTTCACCTTGATGCCGTTCTT-3′
  1. aThe T7 promoter sequence is italiced