Skip to main content

Advertisement

Table 1 Quantitative RT-PCR primers

From: Lmod2 piggyBac mutant mice exhibit dilated cardiomyopathy

Gene Forward (5′→3′) Reverse (5′→3′)
Lmod2 ACCTTATCCCGATTTGCTGAAG ACCTTGAGCATGTCTGCAATG
GAPDH TGTTCCTACCCCCAATGTGTCC GGAGTTGCTGTTGAAGTCGCAG
Tmod1 TGAGCTAGATGAACTAGACCCTG CGGTCCTTAAATTCCTTCGCTTG
ANF CATCACCCTGGGCTTCTTCCT CATCACCCTGGGCTTCTTCCT
BNP GCGGCATGGATCTCCTGAAGG GCGGCATGGATCTCCTGAAGG
Plakoglobin TGGCAACAGACATACACCTACG GGTGGTAGTCTTCTTGAGTGTG
N-cadherin AGCGCAGTCTTACCGAAGG TCGCTGCTTTCATACTGAACTTT
Vinculin GAGGCTGAACTGCTTCAATCA CCAGATTTGACGAGGTGCCTA
β-catenin ATGGAGCCGGACAGAAAAGC CTTGCCACTCAGGGAAGGA
Cx43 ACAGCGGTTGAGTCAGCTTG GAGAGATGGGGAAGGACTTGT