Skip to main content

Advertisement

Table 2 Sequences of primers used to amplify and directly sequence exons 1, 2, 4 of the human HNF-1α gene

From: Studies of genetic variability of the hepatocyte nuclear factor-1α gene in an Indian maturity-onset diabetes of the young family

Exon Sense primer (5′–3′) Antisense primer (5′–3′) Tm (°C) Product size (bp)
1 GGCAGGCAAACGCAACCCACG GAAGGGGGGCTCGTTAGGAGC 60 483
2 CATGCACAGTCCCCACCCTCA CTTCCAGCCCCCACCTATGAG 58 390
4 CAGAACCCTCCCCTTCATGCC GGTGACTGCTGTCAATGGGAC 62 397