Skip to main content

Advertisement

Table 1 Analysed genes and information about sequences of primers, product size and used probes for real-time PCR

From: Characterization of a migrative subpopulation of adult human nasoseptal chondrocytes with progenitor cell features and their potential for in vivo cartilage regeneration strategies

Gene description Gene name Primer left (5′–3′) Primer right (5′–3′) Product size (bp) UPL probe
Glyceraldehyd-3-phosphate dehydrogenase GAPDH gctctctgctcctcctgttc acgaccaaatccgttgactc 115 # 60
Aggrecan ACAN tgcagctgtcactgtagaaactt atagcaggggatggtgagg 112 # 79
Collagen, type I, alpha 1 COL1A1 atgttcagctttgtggacctc ctgtacgcaggtgattggtg 126 # 15
Collagen, type II, alpha 1 COL2A1 ccctggtcttggtggaaac tccttgcattactcccaactg 88 # 19
Fatty acid binding protein 4 FABP4 cctttaaaaatactgagatttccttca ggacacccccatctaaggtt 105 # 72