Skip to main content

Advertisement

Table 1 Primer sequences in this study

From: SIRT1 inhibits adipogenesis and promotes myogenic differentiation in C3H10T1/2 pluripotent cells by regulating Wnt signaling

Gene Primers (sense/antisense 5′–3′ Product length (bp) Ta (°C)
MyoD CGCTCCAACTGCTCTGATGGCAT 280 61
GGGTTCCCTGTTCTGTGTCGCTT
MyHc TCGGGGTCTTGGACATTGCTGG 342 61
CTTTGGCGGGTTTGGGCTTCTG
PPARγ TGGGTGAAACTCTGGGAGATTC 250 60
AGAGGTCCACAGAGCTGATTCC
aP2 GTGTGATGCCTTTGTGGGAAC 235 60
CCTGTCGTCTGCGGTGATT
adiponentin GCTCTCCTGTTCCTCTTAATCCT 437 60
CCAGTGCTGCCGTCATAATG
Cyclin D1 AAATGCCAGAGGCGGATGAG 200 60
AAGAAAGTGCGTTGTGCGGT
sFRP2 AATCGGCATCTAAGTCTT 129 56
GCAATGAGGAATGGTTAC
DACT1 TCTGAGGAATGGAAGTGTG 169 58
GTCTGTCTTTGAGTCTTTGG
β-actin GGCACCACACCTTCTACAATG 133 60
GGGGTGTTGAAGGTCTCAAAC