Skip to main content

Advertisement

Table 1 Primers used in this study

From: MicroRNA-720 promotes in vitro cell migration by targeting Rab35 expression in cervical cancer cells

Name Sequences (5′–3′)
3′UTR-CHP-S CAAAACGCGTCTGTCAACACAAACCTGC
3′UTR-CHP-A CGTAAAGCTTGCCAGACCCCTGAACTAT
3′UTR-INSIG1-S GCTTACGCGTGAGGGAAATGTCTTGGAG
3′UTR-INSIG1-A CGCCAAGCTTGATGTTCAAATCTGGTAG
3′UTR-INTS7-S ATCGACGCGTACAGTTTGGTTTTTCATA
3′UTR-INTS7-A ACTCAAGCTTAAACAAGAAAGAACAATC
3′UTR-KCTD15-S CAACACGCGTATCGTCACAGGAGAAGGT
3′UTR-KCTD15-A AGACAAGCTTTCCAACCCCGCCCCAAC
3′UTR-METTL2B-S ATATACGCGTCCCGTTGTGTTTCCGAGC
3′UTR-METTL2B-A CGGCAAGCTTAGCCCTTCACTAACCCCT
3′UTR-NRXN3-S ACTTACGCGTCTGAGGGGAAAAATGGCT
3′UTR-NRXN3-A TAACAAGCTTTGGCTGGGTGAATGGAC
3′UTR-RAB35-S TTAAACGCGTAAGGAGGGTGCTGTGGAG
3′UTR-RAB35-A ACACAAGCTTCCCATAACCCCCATTCAT
3′UTR-SGK3-S ATATACGCGTGAGACCATCCTGGGCAAC
3′UTR-SGK3-A CCGCAAGCTTCCAGTTATTCTCCTTTAC
3′UTR-RASAL2-S ACTAACGCGTCGACTTCCAAGGTCAATG
3′UTR-RASAL2-A CAGAAAGCTTGTCCAACCAGAACCAGTC
3′UTR-TET2-S CGAGACGCGTAGACTGGTAAAGTGTGGT
3′UTR-TET2-A CACCGAAGCTTATTCACTATTTCTGCCA
INSIG1-MUT-F GAAGTTATTAGATGAAAGGTCGCTCTGAATCTTTAAAACAGAC
INSIG1-MUT-R GTCTGTTTTAAAGATTCAGAGCGACCTTTCATCTAATAACTTC
KCTD15-site1-MUT-F TGTGGACTCCTCCCAGTTGTCGCTCTATGTGCTTTGCCGGGAG
KCTD15-site1-MUT-R CTCCCGGCAAAGCACATAGAGCGACAACTGGGAGGAGTCCACA
KCTD15-site2-MUT-F GAGGGTCCAAAGCTGGCCGTCGCTCCACCAGGGTCCCAGGTGT
KCTD15-site2-MUT-R ACACCTGGGACCCTGGTGGAGCGACGGCCAGCTTTGGACCCTC
METTL2B-MUT-F GTCCAGCCTGGGCAAAATTCGCTCTGACCCTGAATCTGAAAGT
METTL2B-MUT-R ACTTTCAGATTCAGGGTCAGAGCGAATTTTGCCCAGGCTGGAC
NRXN3-MUT-F AGGAAAAAAACTCAAAACAAATCGCTCTGAGACTATTGCCATA
NRXN3-MUT-R TATGGCAATAGTCTCAGAGCGATTTGTTTTGAGTTTTTTTCCT
RAB35-MUT-F CCTCTGAGCGATCAGGCCTCCGGTCGCTCCGTGTGCTTGCAAATTC
RAB35-MUT-R GAATTTGCAAGCACACGGAGCGACCGGAGGCCTGATCGCTCAGAGGC
RASAL2-MUT-F AGTAGGAACTGTTGTGTGTCGCTCTCATGAGCCTGTAGGTTCA
RASAL2-MUT-R TGAACCTACAGGCTCATGAGAGCGACACACAACAGTTCCTACT
TET2-MUT-F ATGTAGAAGACTCTTATGTCGCTCTTAATGCAGAGAAGGCCTT
TET2-MUT-R AAGGCCTTCTCTGCATTAAGAGCGACATAAGAGTCTTCTACAT
  1. Underlined characters indicate regions of the miR-720 seed sequences for mutation in luciferase reporter assay