Skip to main content

Advertisement

Table 1 Primers used for quantitative reverse-transcriptase polymerase chain reaction (RT-PCR)

From: Transplantation of induced pluripotent stem cell-derived renal stem cells improved acute kidney injury

Genes Forward primer (5′–3′) Reverse primer (5′–3′)
m-PAX2 AAGCCCGGAGTGATTGGTG CAGGCGAACATAGTCGGGTT
m-WT1 CAGTTCCCCAACCATTCCTT AAGCTGGGAGGTCATTTGGT
m-Brachyury (Bry) ACCCAGACTCGCCCAATTTT GGAAAGCAGTGGCTGGTGAT
m-CD24 GTTGCACCGTTTCCCGGTAA CCCCTCTGGTGGTAGCGTTA
m-Osr1 ATTCACCCTAAGCCAGAGATCA AGGCCAGGTTAGCGAAATCAA
m-Six2 CTCACCACCACGCAAGTCAG CTCGGAACTGCCTAGCACC
m-Sall1 CTCAACATTTCCAATCCGACCC GGCATCCTTGCTCTTAGTGGG
m-E-cad CTCCAGTCATAGGGAGCTGTC TCTTCTGAGACCTGGGTACAC
m-AQP1 AGGCTTCAATTACCCACTGGA GTGAGCACCGCTGATGTGA
m-PDGFR CCACACCCTTGGGGAATAGT TTTGAAGGGCAAGGAATGTG
m-GAPDH ACTTCAACAGCAACTCCCACTC TAGGCCCCTCCTGTTATTATGG
r-IL-10 TAACTGCACCCACTTCCCAGT TGGCAACCCAAGTAACCCTTA
r-bFGF CGACCCACACGTCAAACTAC CCAGGCGTTCAAAGAAGAAA
r-TGF-β1 GCCCTGGATACCAACTACTGCT GTTGGTTGTAGAGGGCAAGGAC
r-EGF CGTCTCAGTGGTCATGGATTT TCAGAAGAACACGGGAATTGT
r-HGF CTCTCGTTCCTTGGGATTATTG GATCCCCCACAGATGTGTTTAT
r-PDGF ATCGAGCCAAGACACCTCAAAC ATGGGGGCAGTACAGCAAATAC
r-GAPDH AGTGCCAGCCTCGTCTCATAG CGTTGAACTTGCCGTGGGTAG