Skip to main content

Advertisement

Table 1 Gene-specific primers used for real-time PCR assays

From: Peli1 negatively regulates type I interferon induction and antiviral immunity in the CNS

Gene Forward primer Reverse primer
Il1b AAGCCTCGTGCTGTCGGACC TGAGGCCCAAGGCCACAGGT
Il6 CACAGAGGATACCACTCCCAACA TCCACGATTTCCCAGAGAACA
Tnf CATCTTCTCAAAATTCGAGTGACAA CCAGCTGCTCCTCCACTTG
Ifna TGACCTCAAAGCCTGTGTGATG AAGTATTTCCTCACAGCCAGCAG
Ifnb AGCTCCAAGAAAGGACGAACAT GCCCTGTAGGTGAGGTTGATCT
Peli1 CCTTGTCCATGTAAGTTTCTC CAGAGTTCAGAAGTCTGGAACT
Actb CGTGAAAAGATGACCCAGATCA CGTGAAAAGATGACCCAGATCA