Skip to main content

Table 1 Sequences of primers used in RT-PCR and Real-time PCR

From: Induction of ER stress-mediated apoptosis by ceramide via disruption of ER Ca2+ homeostasis in human adenoid cystic carcinoma cells

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
XBP1 CCTTGTAGTTGAGAACCAGGAG GGTCCAAGTTGTCCAGAATGC
GAPDH AGGTCCACCACTGACACGTT GCCTCAAGATCATCAGCAAT
XBP1S CCGCAGCAGGTGCAGG GGGGCTTGGTATATATGTGG
XBP1t CCTTGTAGTTGAGAACCAGG GGGGCTTGGTATATATGTGG
GRP78 TTCTTGTTGGTGGCTCGACT GTCAGCATCTTGGTGGCTTT
CHOP AGGCACTGAGGGTATCATGTT CTGTTTCCGTTTCCTGGTTC
SERCA2α CTGTCCATGTCACTCCACTTCC AGCGGTTACTCCAGTATTGCAG
SERCA2β TCATCTTCCAGATCACACCGC GTCAAGACCAGAACATATC
SERCA3 CACCAGCCCTGAAGAAAGCA AGGAGATGAGGTAGCGGATGAAT