Skip to main content

Table 1 Real-time PCR primers

From: Deficiency in steroid receptor coactivator 3 enhances cytokine production in IgE-stimulated mast cells and passive systemic anaphylaxis in mice

Gene Forward primers Reverse primers
mIL-6 AACGATGATGCACTTGCAGA CTCTGAAGGACTCTGGCTTTG
mTNF-α ACGTGGAACTGGCAGAAGAG GGTCTGGGCCATAGAACTGA
GAPDH GACCACAGTCCATGCCATCAC CATACCAGGAAATGAGCTTGAC