Skip to main content

Table 10 Primers for Golden Gate assembly and sequencing

From: Generation of gene disruptions by transcription activator-like effector nucleases (TALENs) in Xenopus tropicalis embryos

Primer name Sequence
pCR8_F TTGATGCCTGGCAGTTCCCT
pCR8_R CGAACCGAACAGGCTTATGT
CTalF CGTTGACCAACGACCACCTC
CTalR CTAGTTGGGATCCGGCAAC
NTalF GATGACAAGGGTACCGTG