Skip to main content

Advertisement

Table 2 Morpholino antisense oligonucleotide (MO) sequences used in this study.

From: Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene

Name MO sequence
Standard Control (std ctrl) CCTCTTACCTCAGTTACAATTTATA
e10i10 GTTTACCTTAGAGATGGAAGCATGA
ATG2 CAGAATAATCTGGATCTGTGTGTGCAT